Thisis a smooth swing backing track in F Major. The Chord progession is from the Jazz Standard As Long As I Live. Hello, I hope you enjoy this video. Please consider supporting me at by shopping at my online music store or making a small donation at PayPal or Patreon. Shop at my online music store - https://shop.moderndaymusic.net
Welcometo the NEW JERSEY WILDLIFE CAM A 24/7 live streaming HD-quality Internet video broadcast produced by PTZtv. Take a virtual field trip on your desktop, laptop, tablet or smartphone and join us for some great views of the local wildlife in the State of New Jersey, USA.
Floyd"Buddy" McRae, the last surviving original member of the Chords, who popularized the seminal rock 'n' roll classic "Sh-Boom" almost 60 years ago, died Tuesday at Montefiore Medical Center in
Aug 16, 2021. The Owens pupfish, a small blue fish native to the springs in the California desert, was spared from extinction on an August afternoon in 1969 by Phil Pister and his two buckets
. album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNNNGNNNNNDNNNNNFmNNNNNNNNDNNNNNNANNCmNNNNANNGNNNNNNNNNNNNNNNNNNNNANNCmNNNNANNNNNANNNNNNNNNNDNNNNNNNNNNDmNNNNNNNNNNFNNNNNNNNNNDNNNDmNCmNNNANNNGNNNNNNNNNNNNNNNGNNNNNNNNNNCmNNNNNNNNNNNNNNNNANNNNNNGmNNCmNNNNNNNNNNNANNNNDNNNCmNNNNNNDNNNNNANNNNNNNCmNNNNNFNNNNNNNNNNNNNNNGmNNNNCmNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNCmNNNNNNNNNNNANNNNDNNNNCmNNNNNDNNNNNNANNNNNCmNNNNNNNFNNNNNNNNNNNNNNNNNGmNNNCmNNNNNNNNNNNNNNNNNNNNNNFNNNNNNNNNCmNNNNNNNDNNFNNNNNNNNNNCmNNNNNNNNNNNFNNNNNNNNNNCmNNNNNNNNFNNNNNNNNNNNNNNNNNNGmNNNNCmNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNDmNNCmNNNNNNNNNNNANNNNNNDmNNCmNNNNNNDNNNNNNANNNNNNNNCmNNNNNNFNNNNNNNNNNNNNNNNNGmNNNCmNNNNNNNNNNNNNNNNNNNNNNNNFNNNNNNNNNNNNNNNNNNNNANNNNNNNNCmNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAEmNNNENNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi 454 clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
Tabbed by Jared van der Merwe Email g02v0829 Subject Mr Jones Live Across A Wire Live in New York Hi guys I just went to a counting crows concert and I love this band so much I decided it was time to have the full version of this acoustic song on the net! Enjoy It!!! 1 Intro E -B -1-1-1-1-1-1-0-0-G -0-0-0-D -3-3-0-0-A -0-E -So you wanna be a rock n roll star?Well Listen out to what I sayJust get an electric guitarAnd take some time ..learn how to playJust learn how to play! 2 Main Body Am F Well I was down at the New Amsterdam Dm G Just staring at this yellow haired girl Am F G Mr Jones strikes up a conversation with a black-haired flamingo dancer Am F Dm G You no she dancers well his father plays guitar and shes suddenly beautiful Am F G And we all want something beautiful man I wish I was beautiful lalalala Am F Oh, cut up Maria, Dm G Come on, show me some of them Spanish dancers Am F G And pass me a bottle Mr Jones Am F Dm G Am F Oh, believe in me, come on, help me believe in anything, cause I wanna be someone G who believes C F G Mr Jones and me tell each other fairytales C F G And we stare at the beautiful women, shes looking at you nananana, shes looking at me C F G Standing in this bright light coming through his stereo C F G When everybody loves you you should never be lonely Am F Well I wanna paint myself a picture Dm G I wanna paint myself in blue, and red, and black and grey Am F G All the beautiful colours are very very meaningful Am F Ya, you know grey? Its my favourite colour Dm G I just get so confused every day Am F G but if I knew Picasso, I would buy myself a grey guitar and play C F G Mr Jones and me look into the future C F G We stare at all the beautiful women, man shes looking at you, man I dont think so shes looking at me C F G Standing in this spotlight, look at me I, I got myself this grey guitar C F Man when everybody loves me G I hope I never get lonely lalalala Am Yeah, I wanna be a lion F I know, I know, everybody wants to pass as cats Am We all wanna be big, big, big, big, big stars G Yeah but then we get seconds thoughts about that Am F So, believe in me, man I dont believe in anything Am G And I dont wanna be someone to believe You should not believe in me C F G Cause Mr Jones and me, we just went stumbling through the barrio C F G We stare at all the beautiful women, man shes perfect for you Theres got to be someone for me C F G I wanna be Bob Dylan, Mr Jones wishes he was someone just a little more funky C F G Well man when everybody loves you, sometimes thats just about as fucked up as you can be C F G Well cant you hear me cause Im dreaming C F G But I did not go outside yesterday C F Oh, dont wake me cause I was dreaming G And I might just stay inside again today C F G Cause Mr Jones and me, we dont see each other much anymore!
E-Chords uses cookies for functional and analytical purposes. Please read our Privacy Policy for more information.
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratioCCECmFAmBGEmAFGDmADGmDmDFm arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCCCCECCCCCCCCCCCCCCCCCmCFCECCCCmCCECCCCCCCECAmCBCCCECCCCCCmCCCBCCCmCCCFCCECCmCECCCCCCCCCCCCCGCCCCmCCCCCCCCCCCCCCCCCCCECCCCCCCCCCCECCCCCCCCCCCCCCCCCCCCmCCCCCCCECCCCCCmCCCFCCCCCCECCEmCCmCCCECCCCCCCCCCCCmCCCCECCCCCCCCCCmCCCCEmCCCCCCCECCCCmCCCFCCCECCCCCAmCCCECCCCmCCCCFCCACCECCCCCCCCCCCCCCCCACECCCCCACECCCCCACCCmCCCCCECCCCCCCCCCECCCCCCCCCmCCCCCCCCECCCCCCmCECCCBCEmCCECCCCCmCCCACCCCECCCmCECCCCCACCECCCCCCBCCCECCCCCCCCCCCCCCCEmCCCCACCCCCmCCCAECCmCCCCCCCCBCCECCCCFCCECCACECCCCCCCFCCECFCECCCCCCCAmCCCACCCCCCFCECCBCCCCECCCCGCCDmCCCCCCCCmCCCCCCCCCACCCCCCCCGCECCFCCECmCCCCCCCCACCCGCCCmCCCDCCCECCCACCCCGmCFCCCCCDmCCCCDCDCCACCFCACCCCACCCCCCGCCCACCCFCCCCAmCCCCCCCCCACACCDmCCACACDmCCCCCACDmCFCCCCCCCCCCCCCCCAmCCCACCCAmCCCCCDmCCCCCCCCCAmCCCCCGCACCCCCCCAmCGmCCCDmCCCCACACDCCCCCECCAmCCCEmCCDmCCCDECCFmCCCGCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi 1012616 clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
chord live in new york
